Database primers for subgroup determination
Primer pairs were designed to specifically amplify known penaeidin isoforms and they are listed for each species with corresponding realtime PCR amplification parameters indicated in the columns to the right of each primer name. Primer pairs that are italicized have not been tested and the corresponding PCR amplificiation parameters are considered predictions. Conditions were determined using QIAGEN SYBR green reagents and the Light Cycler quantitative PCR analysis system.
Primers were designed to amplify all penaeidin nucleotide isoforms within each class except for those indicated by a superscript letter. Due to the large number of reported polymorphic transcripts, some transcripts may not be included in the amplification and therefore not detected.
| |
|
|
|
Temperature (°C) / Time(sec) |
| Penaeidin targets |
Species name |
Forward primer |
Reverse primer |
Denature |
Anneal |
Elongation |
|
|
|
|
|
|
|
| All penaeidins subgroups |
L. stylirostris |
LSunivpenF1 |
LSunivpenR1 |
95/15 |
60/15 |
72/15 |
| |
P. monodon |
PMunivpenF2 |
LSunivpenR1 |
95/15 |
60/15 |
72/15 |
| |
L. setiferus a |
LSunivpenF1 |
LSunivpenR1 |
95/15 |
60/15 |
72/15 |
| |
P. chinensis |
LSunivpenF1 |
LSunivpenR1 |
95/15 |
60/15 |
72/15 |
| |
L. vannamei b |
LSunivpenF1 |
LSunivpenR1 |
95/15 |
60/15 |
72/15 |
|
|
|
|
|
|
|
| Penaeidin 3 |
L. stylirostris |
LSunivpenF1 |
LStPen3R |
95/15 |
64/20 |
72/15 |
| |
P. monodon |
|
|
95/15 |
64/20 |
72/15 |
| |
L. setiferus |
|
|
95/15 |
64/20 |
72/15 |
| |
P. chinensis |
|
|
95/15 |
64/20 |
72/15 |
|
|
|
|
|
|
|
| Penaeidin 2 |
L. stylirostris |
LSunivpenF1 |
LStPen2R |
95/15 |
64/20 |
72/15 |
| |
P. monodon |
|
|
95/15 |
64/20 |
72/15 |
| |
L. setiferus |
|
|
95/15 |
64/20 |
72/15 |
| |
P. chinensis |
|
|
95/15 |
64/20 |
72/15 |
| |
L. vannamei |
LSunivpenF1 |
LVpen2R |
95/15 |
64/20 |
72/15 |
|
|
|
|
|
|
|
| Penaeidin 4 |
L. stylirostris |
|
|
|
|
|
| |
P. monodon |
|
|
|
|
|
| |
L. setiferus |
|
|
|
|
|
| |
P. chinensis |
|
|
|
|
|
| |
L. vannamei |
LSunivpenF1 |
LVpen4R |
95/15 |
58/20 |
72/15 |
|
|
|
|
|
|
|
|
a Nucleotide polymorphism in AY039207.1(Litset pen4) and BE846756.1(Litset pen3) may not allow proper annealing. Therefore, these transcripts may not be amplified and detected in the analysis.
b Nucleotide polymorphism in AF390142.1(Litvan pen3) and AF390141.1(Litvan-pen3) may not allow proper annealing. Therefore, these transcripts may not be amplified and detected in the analysis.
c Nucleotide polymorphism in BE188520.1(Litvan pen3) may not allow proper annealing. Therefore, ths transcripts may not be amplified and detected in the analysis.
Penaeidin Real Time primers |
Sequence (5'to 3') |
#nts |
LStPen2R |
AGCAATTGCGGGCATCTGGGAA |
23 |
LStPen3R |
GAACGCGCTTGTAAGGTGGTAATGC |
25 |
LSunivpenF1 |
CCATGCGCCTCGTGGTCTG |
19 |
LSunivpenR1 |
CTTGGCAGACCAGGGCGAA |
20 |
LVpen2R |
CATGCATTGCAAACAGGTCTGA |
22 |
LVPen3R |
ACCCGAACCGTTGTATGGAC |
20 |
LVpen4R |
ATCGCACCCAATCGGTCGAA |
20 |
PMunivF2 |
CCTGTGTCCGCCATGCGTC |
19 |
|
